ATU027
ATU027 is a siRNA, which silences expression of protein kinase N3 (PKN3) in the vascular endothelium. ATU027 has previously been shown to inhibit local tumor invasion as well as lymph node and pulmonary metastasis in mouse cancer models.
* Please kindly note that our products are not to be used for therapeutic purposes and cannot be sold to patients.
Synonyms
ATU 027; ATU-027; Atu027; RNA, (A-Gm-A-Cm-U-Um-G-Am-G-Gm-A-Cm-U-Um-C-Cm-U-Gm-G-Am-C-Am-A), complex with RNA (Um-U-Gm-U-Cm-C-Am-G-Gm-A-Am-G-Um-C-Cm-U-Cm-A-Am-G-Um-C-Um) (1:1)
Sequence
RNA, (agacuugaggacuuccuggacaa), complex with RNA (uuguccaggaaguccucaagucu) (1:1)