BOC RNA provides a variety of CpG oligonucleotides (CpG ODN) to help improve the immune stimulation response. All products are purified by HPLC and provided as lyophilized powder.
CpG oligonucleotides (CpG ODN) are short synthetic single-stranded DNA sequences that contain a relatively high proportion of cytidine-guanosine-dinucleotides (CpG). A typical CpG sequence motif consists of at least six nucleotides and a central CpG dinucleotide. Adjacent bases may be arbitrary and may include palindrome sequences.
CpG motifs are common in bacterial and viral DNA, but very rare invertebrates and cytosine is also mainly in methylated form. This difference in the structure of bacterial/viral DNA and vertebrate DNA can be recognized by the immune system, which means that due to its different DNA structures, potential pathogens can be identified very quickly and effectively.
Oligodeoxynucleotide (CpG ODN) containing unmethylated cytosine-guanine dinucleotide is a synthetic agonist of Toll-like receptor 9 (TLR9), which can activate humoral and cellular immunity and has been developed as a vaccine adjuvants to prevent or treat cancer, infectious diseases, and allergies.
Different types of CpG ODNs have different structural characteristics and immune functions. They are generally divided into three types: Type A, Type B, and Type C.
Type A |
|
Type B |
|
Type C |
|
Almost all CpG ODNs used in clinical trials are class B CpG (CpG-B) ODN (also known as K-type ODN). Class A CpG (CpG-A) ODN (also known as D-type ODN) has also been used, but in fewer clinical trials.
BOC RNA provides these three types of CpG ODNs of various species.
Cat No. | Product Name | Type | Species | Sequence | Price |
BRO-00001 | CpG ODN 1585 | A | Mouse | 5’- ggGGTCAACGTTGAgggggg -3’ | Inquiry |
BRO-00002 | Negative control for CpG ODN 1585 | 5'-ggGGTCAAGCTTGAgggggg-3' | Inquiry | ||
BRO-00003 | CpG ODN 2216 | A | Human | 5'-gggggaCGatCGtCGggggg-3' | Inquiry |
BRO-00004 | Negative control for CpG ODN 2216 (ODN 2243) | 5’- ggGGGAGCATGCTGgggggg -3’ | Inquiry | ||
BRO-00005 | Biotinylated CpG ODN 2216 | A | Human | 5’-ggGGGACGATCGTCgggggg-3’ | Inquiry |
BRO-00006 | FITC-labeled CpG ODN 2216 | A | Human | 5’-ggGGGACGATCGTCgggggg-3’ | Inquiry |
BRO-00007 | CpG ODN 2336 | A | Human | 5’- gggGACGACGTCGTGgggggg -3’ | Inquiry |
BRO-00008 | Negative control for ODN 2336 | 5’- gggGAGCAGCTGCTGgggggg -3’ | Inquiry | ||
BRO-00009 | CpG ODN 1668 | B | Mouse | 5'-tccatgaCGttcctgatgct-3' | Inquiry |
BRO-00010 | Negative control for CpG ODN 1668 | 5'-tccatgagcttcctgatgct-3' | Inquiry | ||
BRO-00011 | FITC-labeled CpG ODN 1668 | B | Mouse | 5'-tccatgaCGttcctgatgct-3' | Inquiry |
BRO-00012 | CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
BRO-00013 | Negative control for CpG ODN 1826 (ODN 2138) | 5’- tccatgagcttcctgagctt -3’ | Inquiry | ||
BRO-00014 | Biotin-labeled CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
BRO-00015 | FITC-labeled CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
BRO-00016 | CpG ODN 2006 (ODN 7909) | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
BRO-00017 | Negative control for CpG ODN 2006 (ODN 2137) | 5’- tgctgcttttgtgcttttgtgctt -3’ | Inquiry | ||
BRO-00018 | Biotin-labeled ODN 2006 | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
BRO-00019 | FITC-labeled ODN 2006 | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
BRO-00020 | CpG ODN 2006-G5 | B | Human | 5'-tCGtCGttttgtCGttttgtCGttggggg-3' | Inquiry |
BRO-00021 | Negative control for CpG ODN 2006-G5 | 5’- tgctgcttttgtgcttttgtgcttggggg -3’ | Inquiry | ||
BRO-00022 | CpG ODN 2007 | B | Bovine/porcine | 5’- tCGtCGttgtCGttttgtCGt t -3’ | Inquiry |
BRO-00023 | CpG ODN BW006 (ODN 684) | B | Human/Mouse | 5’-tCGaCGttCGtCGttCGtCGttc-3’ | Inquiry |
BRO-00024 | Negative control for CpG ODN BW006 (ODN BW007) | 5’-tgcagcttgctgcttgctgcttc-3’ | Inquiry | ||
BRO-00025 | CpG ODN D-SL01 | B | Multispecies | 5’-tCGCGaCGttCGccCGaCGttCGgta-3’ | Inquiry |
BRO-00026 | CpG ODN 2395 | C | Human/ Mouse | 5'-tCGtCGttttCGgCGCGCGcCG-3' | Inquiry |
BRO-00027 | Negative control for CpG ODN 2395 | 5’-tgctgcttttggggggcccccc -3’ | Inquiry | ||
BRO-00028 | FITC-labeled ODN 2395 | C | Human/ Mouse | 5'-tCGtCGttttCGgCGCGCGcCG-3' | Inquiry |
BRO-00029 | CpG ODN M362 | C | Human/ Mouse | 5’-tCGtCGtCGttCGaaCGaCGttgat-3’ | Inquiry |
BRO-00030 | Negative control for CpG ODN M362 | 5’- tgctgctgcttg:caagcagcttgat -3’ | Inquiry | ||
BRO-00031 | CpG ODN D-SL03 | C | Multispecies | 5’-tCGCGaaCGttCGcCGCGttCGaaCGCGg-3’ | Inquiry |
BRO-00032 | CpG ODN C792 | C | Human/ Mouse | 5'-tCGaaCGaaCGaaCGttCGaaCGttCGaat-3' | Inquiry |
BRO-00033 | CpG ODN C274 | C | Human/ Mouse | 5'-tCGtCGaaCGttCGagatgat-3' | Inquiry |
Custom manufacturing services are available to help develop or expand CpG oligonucleotides.