Inquiry Basket
Services Details
BOC RNA provides a variety of CpG oligonucleotides (CpG ODN) to help improve the immune stimulation response. All products are purified by HPLC and provided as lyophilized powder.
What is CpG ODN?
CpG oligonucleotides (CpG ODN) are short synthetic single-stranded DNA sequences that contain a relatively high proportion of cytidine-guanosine-dinucleotides (CpG). A typical CpG sequence motif consists of at least six nucleotides and a central CpG dinucleotide. Adjacent bases may be arbitrary and may include palindrome sequences.
CpG motifs are common in bacterial and viral DNA, but very rare invertebrates and cytosine is also mainly in methylated form. This difference in the structure of bacterial/viral DNA and vertebrate DNA can be recognized by the immune system, which means that due to its different DNA structures, potential pathogens can be identified very quickly and effectively.
Application and Classification of CpG ODN
Oligodeoxynucleotide (CpG ODN) containing unmethylated cytosine-guanine dinucleotide is a synthetic agonist of Toll-like receptor 9 (TLR9), which can activate humoral and cellular immunity and has been developed as a vaccine adjuvants to prevent or treat cancer, infectious diseases, and allergies.
Different types of CpG ODNs have different structural characteristics and immune functions. They are generally divided into three types: Type A, Type B, and Type C.
| Type A |
|
| Type B |
|
| Type C |
|
Almost all CpG ODNs used in clinical trials are class B CpG (CpG-B) ODN (also known as K-type ODN). Class A CpG (CpG-A) ODN (also known as D-type ODN) has also been used, but in fewer clinical trials.
CpG ODN Catalog of BOC RNA
| Cat No. | Product Name | Type | Species | Sequence | Price |
| BRO-00001 | CpG ODN 1585 | A | Mouse | 5’- ggGGTCAACGTTGAgggggg -3’ | Inquiry |
| BRO-00002 | Negative control for CpG ODN 1585 | 5'-ggGGTCAAGCTTGAgggggg-3' | Inquiry | ||
| BRO-00003 | CpG ODN 2216 | A | Human | 5'-gggggaCGatCGtCGggggg-3' | Inquiry |
| BRO-00004 | Negative control for CpG ODN 2216 (ODN 2243) | 5’- ggGGGAGCATGCTGgggggg -3’ | Inquiry | ||
| BRO-00005 | Biotinylated CpG ODN 2216 | A | Human | 5’-ggGGGACGATCGTCgggggg-3’ | Inquiry |
| BRO-00006 | FITC-labeled CpG ODN 2216 | A | Human | 5’-ggGGGACGATCGTCgggggg-3’ | Inquiry |
| BRO-00007 | CpG ODN 2336 | A | Human | 5’- gggGACGACGTCGTGgggggg -3’ | Inquiry |
| BRO-00008 | Negative control for ODN 2336 | 5’- gggGAGCAGCTGCTGgggggg -3’ | Inquiry | ||
| BRO-00009 | CpG ODN 1668 | B | Mouse | 5'-tccatgaCGttcctgatgct-3' | Inquiry |
| BRO-00010 | Negative control for CpG ODN 1668 | 5'-tccatgagcttcctgatgct-3' | Inquiry | ||
| BRO-00011 | FITC-labeled CpG ODN 1668 | B | Mouse | 5'-tccatgaCGttcctgatgct-3' | Inquiry |
| BRO-00012 | CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
| BRO-00013 | Negative control for CpG ODN 1826 (ODN 2138) | 5’- tccatgagcttcctgagctt -3’ | Inquiry | ||
| BRO-00014 | Biotin-labeled CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
| BRO-00015 | FITC-labeled CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
| BRO-00016 | CpG ODN 2006 (ODN 7909) | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
| BRO-00017 | Negative control for CpG ODN 2006 (ODN 2137) | 5’- tgctgcttttgtgcttttgtgctt -3’ | Inquiry | ||
| BRO-00018 | Biotin-labeled ODN 2006 | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
| BRO-00019 | FITC-labeled ODN 2006 | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
| BRO-00020 | CpG ODN 2006-G5 | B | Human | 5'-tCGtCGttttgtCGttttgtCGttggggg-3' | Inquiry |
| BRO-00021 | Negative control for CpG ODN 2006-G5 | 5’- tgctgcttttgtgcttttgtgcttggggg -3’ | Inquiry | ||
| BRO-00022 | CpG ODN 2007 | B | Bovine/porcine | 5’- tCGtCGttgtCGttttgtCGt t -3’ | Inquiry |
| BRO-00023 | CpG ODN BW006 (ODN 684) | B | Human/Mouse | 5’-tCGaCGttCGtCGttCGtCGttc-3’ | Inquiry |
| BRO-00024 | Negative control for CpG ODN BW006 (ODN BW007) | 5’-tgcagcttgctgcttgctgcttc-3’ | Inquiry | ||
| BRO-00025 | CpG ODN D-SL01 | B | Multispecies | 5’-tCGCGaCGttCGccCGaCGttCGgta-3’ | Inquiry |
| BRO-00026 | CpG ODN 2395 | C | Human/ Mouse | 5'-tCGtCGttttCGgCGCGCGcCG-3' | Inquiry |
| BRO-00027 | Negative control for CpG ODN 2395 | 5’-tgctgcttttggggggcccccc -3’ | Inquiry | ||
| BRO-00028 | FITC-labeled ODN 2395 | C | Human/ Mouse | 5'-tCGtCGttttCGgCGCGCGcCG-3' | Inquiry |
| BRO-00029 | CpG ODN M362 | C | Human/ Mouse | 5’-tCGtCGtCGttCGaaCGaCGttgat-3’ | Inquiry |
| BRO-00030 | Negative control for CpG ODN M362 | 5’- tgctgctgcttg:caagcagcttgat -3’ | Inquiry | ||
| BRO-00031 | CpG ODN D-SL03 | C | Multispecies | 5’-tCGCGaaCGttCGcCGCGttCGaaCGCGg-3’ | Inquiry |
| BRO-00032 | CpG ODN C792 | C | Human/ Mouse | 5'-tCGaaCGaaCGaaCGttCGaaCGttCGaat-3' | Inquiry |
| BRO-00033 | CpG ODN C274 | C | Human/ Mouse | 5'-tCGtCGaaCGttCGagatgat-3' | Inquiry |
Custom CpG ODN Services
Custom manufacturing services are available to help develop or expand CpG oligonucleotides.
* Only for research. Not suitable for any diagnostic or therapeutic use.
Online Inquiry
Services
Products
Highlighted Services
GMP Oligonucleotide Manufacturing Service
For more than 15 years, BOC Sciences has been manufacturing oligonucleotides for pre-clinical, pharmaceutical, food safety, and animal health industries. We provide customized and flexible oligonucleotide GMP or non-GMP production services to meet different production needs.
Lipid Nanoparticle(LNP) for RNA Delivery
BOC Sciences offers comprehensive LNP- mRNA delivery services tailored to meet the specific needs of mRNA vaccine development. Our expertise in nanoparticle formulation and mRNA chemistry enables us to design custom LNP formulations optimized for stability, efficacy, and safety.
BOC Sciences promises to offer you with GalNAc-siRNA conjugation services to help you conduct further research on GalNAc-siRNA conjugates and explore their mores omnics capabilities, the working mechanism as well as their potential therapeutic profiles.
BOC Sciences offers aptamer customization services to generate high-quality aptamers tailored to your goals, delivering excellent results even for the most difficult target molecules.
Peptide-Oligonucleotide Conjugation
BOC Sciences is committed to providing our customers with comprehensive modification and labeling, offering affordable custom oligonucleotides or peptide-oligonucleotide conjugates.
