CpG oligonucleotides (CpG ODNs) are synthetic single-stranded DNA molecules containing unmethylated CpG motifs that can trigger robust immune responses through Toll-like receptor 9 (TLR9) activation. These synthetic sequences have become powerful tools for modulating innate and adaptive immunity, supporting applications from vaccine adjuvants and cancer immunotherapy research to autoimmune disease models and fundamental immunological studies. The performance of CpG ODNs is highly dependent on precise sequence design, backbone chemistry, and synthesis quality. At BOC Sciences, we provide state-of-the-art CpG ODN synthesis services, delivering reliable, reproducible, and application-ready oligonucleotides tailored to the specific needs of researchers.
Developing CpG ODNs for immunological studies or preclinical applications involves a series of technical challenges. Low-quality or poorly designed oligonucleotides may lead to weak immune stimulation, non-specific activation, or misleading experimental outcomes. Our CpG ODN synthesis services directly address these concerns:
Partnering with BOC Sciences for CpG ODN synthesis means eliminating common experimental barriers—variability, instability, off-target effects, and scalability issues—while gaining access to high-performance oligonucleotides optimized for immunological research and therapeutic exploration.
At BOC Sciences, our CpG ODN services extend far beyond standard oligonucleotide synthesis. We provide a fully integrated platform that combines advanced chemistry, customizable design, and rigorous analytical validation to deliver CpG ODNs optimized for diverse immunological and preclinical applications. By uniting scientific expertise with cutting-edge technology, we ensure that every CpG oligonucleotide performs reliably and consistently in even the most demanding research settings.
BOC Sciences offers a diverse portfolio of standard CpG oligonucleotides designed to meet the varied immunological needs of researchers across disciplines. Each CpG ODN class has been carefully characterized for its distinct immune-stimulatory properties, allowing scientists to select the most suitable type for their experimental goals. Whether the research focus is on vaccine adjuvant discovery, tumor immunology, or innate immune signaling, our standardized products deliver consistent performance and reproducibility.
| Cat No. | Product Name | Type | Species | Sequence | Price |
| BRO-00001 | CpG ODN 1585 | A | Mouse | 5'- ggGGTCAACGTTGAgggggg -3' | Inquiry |
| BRO-00002 | Negative control for CpG ODN 1585 | 5'-ggGGTCAAGCTTGAgggggg-3' | Inquiry | ||
| BRO-00003 | CpG ODN 2216 | A | Human | 5'-gggggaCGatCGtCGggggg-3' | Inquiry |
| BRO-00004 | Negative control for CpG ODN 2216 (ODN 2243) | 5'- ggGGGAGCATGCTGgggggg -3' | Inquiry | ||
| BRO-00005 | Biotinylated CpG ODN 2216 | A | Human | 5'-ggGGGACGATCGTCgggggg-3' | Inquiry |
| BRO-00006 | FITC-labeled CpG ODN 2216 | A | Human | 5'-ggGGGACGATCGTCgggggg-3' | Inquiry |
| BRO-00007 | CpG ODN 2336 | A | Human | 5'- gggGACGACGTCGTGgggggg -3' | Inquiry |
| BRO-00008 | Negative control for ODN 2336 | 5'- gggGAGCAGCTGCTGgggggg -3' | Inquiry | ||
| BRO-00009 | CpG ODN 1668 | B | Mouse | 5'-tccatgaCGttcctgatgct-3' | Inquiry |
| BRO-00010 | Negative control for CpG ODN 1668 | 5'-tccatgagcttcctgatgct-3' | Inquiry | ||
| BRO-00011 | FITC-labeled CpG ODN 1668 | B | Mouse | 5'-tccatgaCGttcctgatgct-3' | Inquiry |
| BRO-00012 | CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
| BRO-00013 | Negative control for CpG ODN 1826 (ODN 2138) | 5'- tccatgagcttcctgagctt -3' | Inquiry | ||
| BRO-00014 | Biotin-labeled CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
| BRO-00015 | FITC-labeled CpG ODN 1826 | B | Mouse | 5'-tccatgaCGttcctgaCGtt-3' | Inquiry |
| BRO-00016 | CpG ODN 2006 (ODN 7909) | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
| BRO-00017 | Negative control for CpG ODN 2006 (ODN 2137) | 5'- tgctgcttttgtgcttttgtgctt -3' | Inquiry | ||
| BRO-00018 | Biotin-labeled ODN 2006 | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
| BRO-00019 | FITC-labeled ODN 2006 | B | Human | 5'-tCGtCGttttgtCGttttgtCGtt-3' | Inquiry |
| BRO-00020 | CpG ODN 2006-G5 | B | Human | 5'-tCGtCGttttgtCGttttgtCGttggggg-3' | Inquiry |
| BRO-00021 | Negative control for CpG ODN 2006-G5 | 5'- tgctgcttttgtgcttttgtgcttggggg -3' | Inquiry | ||
| BRO-00022 | CpG ODN 2007 | B | Bovine/porcine | 5'- tCGtCGttgtCGttttgtCGt t -3' | Inquiry |
| BRO-00023 | CpG ODN BW006 (ODN 684) | B | Human/Mouse | 5'-tCGaCGttCGtCGttCGtCGttc-3' | Inquiry |
| BRO-00024 | Negative control for CpG ODN BW006 (ODN BW007) | 5'-tgcagcttgctgcttgctgcttc-3' | Inquiry | ||
| BRO-00025 | CpG ODN D-SL01 | B | Multispecies | 5'-tCGCGaCGttCGccCGaCGttCGgta-3' | Inquiry |
| BRO-00026 | CpG ODN 2395 | C | Human/ Mouse | 5'-tCGtCGttttCGgCGCGCGcCG-3' | Inquiry |
| BRO-00027 | Negative control for CpG ODN 2395 | 5'-tgctgcttttggggggcccccc -3' | Inquiry | ||
| BRO-00028 | FITC-labeled ODN 2395 | C | Human/ Mouse | 5'-tCGtCGttttCGgCGCGCGcCG-3' | Inquiry |
| BRO-00029 | CpG ODN M362 | C | Human/ Mouse | 5'-tCGtCGtCGttCGaaCGaCGttgat-3' | Inquiry |
| BRO-00030 | Negative control for CpG ODN M362 | 5'- tgctgctgcttg:caagcagcttgat -3' | Inquiry | ||
| BRO-00031 | CpG ODN D-SL03 | C | Multispecies | 5'-tCGCGaaCGttCGcCGCGttCGaaCGCGg-3' | Inquiry |
| BRO-00032 | CpG ODN C792 | C | Human/ Mouse | 5'-tCGaaCGaaCGaaCGttCGaaCGttCGaat-3' | Inquiry |
| BRO-00033 | CpG ODN C274 | C | Human/ Mouse | 5'-tCGtCGaaCGttCGagatgat-3' | Inquiry |
By offering all major classes of CpG ODNs, BOC Sciences ensures that researchers can access well-characterized, application-ready products without the uncertainty of untested designs. Each product is manufactured with rigorous quality control and validated for structural accuracy, giving scientists confidence in both reliability and performance. This comprehensive product line allows for seamless integration into immunology, oncology, and vaccine research, supporting faster progress from experimental design to breakthrough discoveries.
BOC Sciences provides a highly adaptable CpG ODN synthesis platform, designed to accommodate the specific needs of researchers working in immunology, oncology, vaccine development, and beyond. Our expertise in nucleic acid chemistry ensures that every oligonucleotide is optimized not only for structural integrity but also for functional performance in complex biological systems.
(1) Biotin – for affinity purification and pull-down assays.
(2) Fluorescent Dyes (FAM, Cy3, Cy5, etc.) – for imaging, tracking, and quantification.
(3)Amino or Thiol Groups – for conjugation with proteins, lipids, or nanoparticles.
With these flexible options, BOC Sciences transforms CpG ODN synthesis from a one-size-fits-all process into a customized, research-driven service that empowers scientists to achieve superior outcomes.
At BOC Sciences, every CpG oligonucleotide project is managed through a structured, transparent, and scientifically rigorous workflow. Our process is designed not only to guarantee product quality but also to provide researchers with confidence, clarity, and efficiency at each stage.
This end-to-end workflow guarantees that every CpG ODN synthesized at BOC Sciences is scientifically robust, reproducible, and tailored to the researcher's exact specifications—ensuring that clients can progress with confidence from discovery to preclinical exploration.
Selecting the right partner for CpG oligonucleotide synthesis can dramatically influence research efficiency, data reliability, and project success. BOC Sciences distinguishes itself through a combination of scientific expertise, advanced technology, and client-focused flexibility.
Our team of seasoned scientists has decades of combined experience in DNA and RNA chemistry, enabling us to design, synthesize, and modify CpG ODNs with unmatched precision. From motif selection to structural optimization, we provide expert guidance that ensures your oligonucleotides achieve maximum biological effect.
We provide all major classes of CpG ODNs (A, B, C, and P), along with fully customized variants. This broad coverage allows researchers to compare multiple structural designs and select the one most suitable for their project, whether focused on innate immune activation, antibody production, or combinational immunotherapy.
We understand that no two projects are alike. Whether you require phosphorothioate stabilization, fluorescent labeling, biotin conjugation, or conjugation-ready oligonucleotides, our platform delivers tailored solutions to fit your exact specifications.
From milligram quantities for exploratory studies to gram-scale synthesis for extended preclinical projects, our scalable production ensures smooth progression through different stages of research without compromising quality.
By combining scientific excellence, stringent quality standards, and a client-first approach, BOC Sciences provides CpG ODN synthesis services that empower researchers to overcome technical barriers and accelerate breakthroughs in immunological and preclinical research.
CpG oligonucleotides (CpG ODNs) are versatile immunostimulatory agents that act through TLR9-mediated pathways to modulate both innate and adaptive immunity. Their diverse structural classes and modifiable chemistries make them indispensable in multiple areas of preclinical research. BOC Sciences delivers CpG ODNs that are carefully designed, synthesized, and validated to support a wide spectrum of cutting-edge applications.
CpG ODNs are among the most studied nucleic acid adjuvants due to their ability to promote strong Th1-polarized immune responses.
Harnessing the immune system to fight cancer requires strong and sustained activation of innate and adaptive responses—an area where CpG ODNs excel.
CpG ODNs are powerful tools to dissect immune dysregulation mechanisms in autoimmunity.
CpG ODNs act as standardized immune triggers in both in vitro and in vivo systems, supporting discovery research and translational studies.
BOC Sciences empowers researchers to advance vaccine innovation, oncology breakthroughs, autoimmune disease modeling, allergy therapies, infectious disease research, and biomarker discovery. Each CpG ODN we synthesize is engineered for reproducibility, stability, and scientific impact.
Contact BOC Sciences today to discuss your CpG ODN synthesis requirements and take the next step toward breakthrough scientific results.
Get A QuoteCpG oligonucleotides (CpG ODN) are short synthetic single-stranded DNA sequences that contain a relatively high proportion of cytidine-guanosine-dinucleotides (CpG). A typical CpG sequence motif consists of at least six nucleotides and a central CpG dinucleotide. Adjacent bases may be arbitrary and may include palindrome sequences. CpG motifs are common in bacterial and viral DNA, but very rare invertebrates and cytosine is also mainly in methylated form. This difference in the structure of bacterial/viral DNA and vertebrate DNA can be recognized by the immune system, which means that due to its different DNA structures, potential pathogens can be identified very quickly and effectively.
Oligodeoxynucleotide (CpG ODN) containing unmethylated cytosine-guanine dinucleotide is a synthetic agonist of Toll-like receptor 9 (TLR9), which can activate humoral and cellular immunity and has been developed as a vaccine adjuvants to prevent or treat cancer, infectious diseases, and allergies. Different types of CpG ODNs have different structural characteristics and immune functions. They are generally divided into three types: Type A, Type B, and Type C. Type A With a palindromic sequence containing CpG dinucleotide as its core Poly G tails at both ends Partial phosphorothioated modifications on the phosphodiester bond skeleton Forming a high-level structure through the palindrome sequence and poly G tail to activate plasmacytoid dendritic cells and induce a large number of type I interferons Type B Linear CpG ODN modified with full phosphorothioates Have strong immunostimulatory activity on B cells, but cannot activate plasmacytoid dendritic cells Type C Modified with full phosphorothioates Form a dimer through the palindromic sequence, and have the activity of Class A and Class B CpG ODNs Activate both plasmacytoid dendritic cells and B cells Almost all CpG ODNs used in clinical trials are class B CpG (CpG-B) ODN (also known as K-type ODN). Class A CpG (CpG-A) ODN (also known as D-type ODN) has also been used, but in fewer clinical trials.
Class A CpG ODNs induce strong IFN-α secretion from plasmacytoid dendritic cells; Class B CpG ODNs primarily stimulate B-cell proliferation and antibody production; Class C combines both interferon induction and B-cell activation; Class P CpG ODNs are engineered for broader immune pathway activation. Choosing the right class depends on the specific immunological application.
Natural DNA backbones are rapidly degraded by nucleases in biological systems, limiting immunostimulatory activity. Phosphorothioate backbone modifications enhance stability, prolong half-life, and improve in vivo performance. BOC Sciences offers partial or full backbone modifications to balance efficacy, safety, and functional outcomes.
Yes. We provide biotin, fluorescent dyes (FAM, Cy3, Cy5), amino, and thiol modifications for applications such as tracking, affinity purification, imaging, and conjugation with delivery systems (e.g., liposomes, proteins, or nanoparticles). These modifications expand the utility of CpG ODNs in complex experimental settings.
CpG ODNs are typically stable for long-term storage when lyophilized and kept at -20 °C. In solution, stability depends on buffer composition and modification type. At BOC Sciences, we provide guidance on optimal storage conditions and can supply CpG ODNs in lyophilized form to ensure maximum shelf life.
Loading ......