Tel:
Email:

CpG Oligonucleotides (CpG ODN) Synthesis

CpG oligonucleotides (CpG ODNs) are synthetic single-stranded DNA molecules containing unmethylated CpG motifs that can trigger robust immune responses through Toll-like receptor 9 (TLR9) activation. These synthetic sequences have become powerful tools for modulating innate and adaptive immunity, supporting applications from vaccine adjuvants and cancer immunotherapy research to autoimmune disease models and fundamental immunological studies. The performance of CpG ODNs is highly dependent on precise sequence design, backbone chemistry, and synthesis quality. At BOC Sciences, we provide state-of-the-art CpG ODN synthesis services, delivering reliable, reproducible, and application-ready oligonucleotides tailored to the specific needs of researchers.

Facing CpG ODN Challenges? Our Synthesis Services Deliver Precision and Reliability.

Developing CpG ODNs for immunological studies or preclinical applications involves a series of technical challenges. Low-quality or poorly designed oligonucleotides may lead to weak immune stimulation, non-specific activation, or misleading experimental outcomes. Our CpG ODN synthesis services directly address these concerns:

  • Ensuring Experimental Reproducibility - By synthesizing CpG ODNs with exceptional sequence fidelity and chemical stability, we minimize batch-to-batch variation and guarantee reliable outcomes across studies.
  • Enhancing Immunostimulatory Activity - Optimized phosphorothioate backbones and sequence designs enhance nuclease resistance, enabling longer in vivo half-life and sustained immune activation.
  • Reducing Off-Target Immune Responses - Custom sequence modifications minimize unwanted cytokine release or non-specific TLR activation, ensuring data accuracy and biological relevance.
  • Supporting High-Impact Research: Whether for mechanistic studies of innate immunity, vaccine formulation, or biomarker discovery, our CpG ODN synthesis ensures that researchers can confidently advance their projects.

Partnering with BOC Sciences for CpG ODN synthesis means eliminating common experimental barriers—variability, instability, off-target effects, and scalability issues—while gaining access to high-performance oligonucleotides optimized for immunological research and therapeutic exploration.

Comprehensive CpG ODN Synthesis Services & Product Portfolio

At BOC Sciences, our CpG ODN services extend far beyond standard oligonucleotide synthesis. We provide a fully integrated platform that combines advanced chemistry, customizable design, and rigorous analytical validation to deliver CpG ODNs optimized for diverse immunological and preclinical applications. By uniting scientific expertise with cutting-edge technology, we ensure that every CpG oligonucleotide performs reliably and consistently in even the most demanding research settings.

Standard CpG ODN Product Portfolio

BOC Sciences offers a diverse portfolio of standard CpG oligonucleotides designed to meet the varied immunological needs of researchers across disciplines. Each CpG ODN class has been carefully characterized for its distinct immune-stimulatory properties, allowing scientists to select the most suitable type for their experimental goals. Whether the research focus is on vaccine adjuvant discovery, tumor immunology, or innate immune signaling, our standardized products deliver consistent performance and reproducibility.

Cat No.Product NameTypeSpeciesSequencePrice
BRO-00001CpG ODN 1585AMouse5'- ggGGTCAACGTTGAgggggg -3'Inquiry
BRO-00002Negative control for CpG ODN 15855'-ggGGTCAAGCTTGAgggggg-3'Inquiry
BRO-00003CpG ODN 2216AHuman5'-gggggaCGatCGtCGggggg-3'Inquiry
BRO-00004Negative control for CpG ODN 2216 (ODN 2243)5'- ggGGGAGCATGCTGgggggg -3'Inquiry
BRO-00005Biotinylated CpG ODN 2216AHuman5'-ggGGGACGATCGTCgggggg-3'Inquiry
BRO-00006FITC-labeled CpG ODN 2216AHuman5'-ggGGGACGATCGTCgggggg-3'Inquiry
BRO-00007CpG ODN 2336AHuman5'- gggGACGACGTCGTGgggggg -3'Inquiry
BRO-00008Negative control for ODN 23365'- gggGAGCAGCTGCTGgggggg -3'Inquiry
BRO-00009CpG ODN 1668BMouse5'-tccatgaCGttcctgatgct-3'Inquiry
BRO-00010Negative control for CpG ODN 16685'-tccatgagcttcctgatgct-3'Inquiry
BRO-00011FITC-labeled CpG ODN 1668BMouse5'-tccatgaCGttcctgatgct-3'Inquiry
BRO-00012CpG ODN 1826BMouse5'-tccatgaCGttcctgaCGtt-3'Inquiry
BRO-00013Negative control for CpG ODN 1826 (ODN 2138)5'- tccatgagcttcctgagctt -3'Inquiry
BRO-00014Biotin-labeled CpG ODN 1826BMouse5'-tccatgaCGttcctgaCGtt-3'Inquiry
BRO-00015FITC-labeled CpG ODN 1826BMouse5'-tccatgaCGttcctgaCGtt-3'Inquiry
BRO-00016CpG ODN 2006 (ODN 7909)BHuman5'-tCGtCGttttgtCGttttgtCGtt-3'Inquiry
BRO-00017Negative control for CpG ODN 2006 (ODN 2137)5'- tgctgcttttgtgcttttgtgctt -3'Inquiry
BRO-00018Biotin-labeled ODN 2006BHuman5'-tCGtCGttttgtCGttttgtCGtt-3'Inquiry
BRO-00019FITC-labeled ODN 2006BHuman5'-tCGtCGttttgtCGttttgtCGtt-3'Inquiry
BRO-00020CpG ODN 2006-G5BHuman5'-tCGtCGttttgtCGttttgtCGttggggg-3'Inquiry
BRO-00021Negative control for CpG ODN 2006-G55'- tgctgcttttgtgcttttgtgcttggggg -3'Inquiry
BRO-00022CpG ODN 2007BBovine/porcine5'- tCGtCGttgtCGttttgtCGt t -3'Inquiry
BRO-00023CpG ODN BW006 (ODN 684)BHuman/Mouse5'-tCGaCGttCGtCGttCGtCGttc-3'Inquiry
BRO-00024Negative control for CpG ODN BW006 (ODN BW007)5'-tgcagcttgctgcttgctgcttc-3'Inquiry
BRO-00025CpG ODN D-SL01BMultispecies5'-tCGCGaCGttCGccCGaCGttCGgta-3'Inquiry
BRO-00026CpG ODN 2395CHuman/ Mouse5'-tCGtCGttttCGgCGCGCGcCG-3'Inquiry
BRO-00027Negative control for CpG ODN 23955'-tgctgcttttggggggcccccc -3'Inquiry
BRO-00028FITC-labeled ODN 2395CHuman/ Mouse5'-tCGtCGttttCGgCGCGCGcCG-3'Inquiry
BRO-00029CpG ODN M362CHuman/ Mouse5'-tCGtCGtCGttCGaaCGaCGttgat-3'Inquiry
BRO-00030Negative control for CpG ODN M3625'- tgctgctgcttg:caagcagcttgat -3'Inquiry
BRO-00031CpG ODN D-SL03CMultispecies5'-tCGCGaaCGttCGcCGCGttCGaaCGCGg-3'Inquiry
BRO-00032CpG ODN C792CHuman/ Mouse5'-tCGaaCGaaCGaaCGttCGaaCGttCGaat-3'Inquiry
BRO-00033CpG ODN C274CHuman/ Mouse5'-tCGtCGaaCGttCGagatgat-3'Inquiry

By offering all major classes of CpG ODNs, BOC Sciences ensures that researchers can access well-characterized, application-ready products without the uncertainty of untested designs. Each product is manufactured with rigorous quality control and validated for structural accuracy, giving scientists confidence in both reliability and performance. This comprehensive product line allows for seamless integration into immunology, oncology, and vaccine research, supporting faster progress from experimental design to breakthrough discoveries.

Custom CpG ODNs Synthesis Options

BOC Sciences provides a highly adaptable CpG ODN synthesis platform, designed to accommodate the specific needs of researchers working in immunology, oncology, vaccine development, and beyond. Our expertise in nucleic acid chemistry ensures that every oligonucleotide is optimized not only for structural integrity but also for functional performance in complex biological systems.

Backbone Engineering

  • Phosphorothioate (PS) Modifications: Increase nuclease resistance and prolong in vivo stability without compromising immunostimulatory activity.
  • Mixed Backbone Designs: Partial PS modification for balancing stability with reduced toxicity.
  • Alternative Backbone Chemistries: Tailored designs for unique experimental requirements, including increased flexibility for conjugation.

Sequence Optimization

  • Motif Selection & Analysis: Bioinformatics-driven design of CpG motifs to maximize TLR9 activation.
  • Custom Motif Integration: Insertion of specific CpG-rich regions adapted to different immune cell types.
  • Secondary Structure Considerations: Preventing unwanted folding or hybridization that could interfere with immunostimulation.

Terminal and Internal Modifications

  • Labeling Options:

(1) Biotin – for affinity purification and pull-down assays.

(2) Fluorescent Dyes (FAM, Cy3, Cy5, etc.) – for imaging, tracking, and quantification.

(3)Amino or Thiol Groups – for conjugation with proteins, lipids, or nanoparticles.

  • Conjugation-Ready Designs: CpG ODNs engineered for coupling with delivery systems such as liposomes, antibodies, or polymer carriers.
  • Spacer Incorporation: Adjustable linkers or spacers to optimize accessibility of functional groups.

Scalable Production

  • Flexible Quantities: From milligram-scale synthesis for exploratory assays to gram-scale production for preclinical studies.
  • High-Throughput Capability: Parallel synthesis of multiple CpG ODN variants for screening applications.
  • Consistent Purity Standards: Uniform production pipelines ensure reproducibility regardless of scale.

Project-Specific Support

  • Consultative Design Services: Collaborative discussions with our scientific team to define motifs, modifications, and synthesis scale.
  • Flexible Delivery Formats: CpG ODNs supplied lyophilized or in solution, depending on client requirements.
  • Post-Delivery Technical Support: Guidance on storage, handling, and experimental application.

With these flexible options, BOC Sciences transforms CpG ODN synthesis from a one-size-fits-all process into a customized, research-driven service that empowers scientists to achieve superior outcomes.

Workflow of Our CpG ODN Synthesis Services

At BOC Sciences, every CpG oligonucleotide project is managed through a structured, transparent, and scientifically rigorous workflow. Our process is designed not only to guarantee product quality but also to provide researchers with confidence, clarity, and efficiency at each stage.

01

Initial Consultation & Project Design

  • Needs Assessment: Our scientific team works closely with clients to define project objectives, whether for immunological studies, vaccine adjuvant research, or preclinical testing.
  • Sequence Guidance: Bioinformatics support helps identify the most effective CpG motifs and structural class (A, B, C, or P) for the intended application.
  • Modification Planning: Determination of backbone modifications, labeling strategies, and required conjugation functionalities.
02

Sequence Optimization & Feasibility Analysis

  • Structural Evaluation: Ensuring CpG ODN sequences avoid unwanted secondary structures or hybridization artifacts.
  • Motif Validation: Selection of CpG-rich regions tailored to specific immune activation pathways (e.g., B-cell proliferation vs. IFN-α induction).
  • Feasibility Report: A documented plan including synthesis approach, modification details, and expected turnaround.
03

Custom Synthesis Execution

  • Solid-Phase Synthesis: Automated phosphoramidite chemistry under tightly controlled conditions.
  • Coupling Efficiency Monitoring: Real-time tracking of each addition step to maximize yield and fidelity.
  • Backbone Modification Integration: Incorporation of phosphorothioate or mixed-backbone structures for enhanced stability.
04

Purification & Quality Control

  • High-Resolution Purification: HPLC or PAGE purification eliminates truncated products and ensures >95% purity.
  • Analytical Characterization: Verification of identity and structural integrity by LC-MS and MALDI-TOF.
  • Optional Testing: Endotoxin, sterility, and stability testing available for sensitive immunology projects.
05

Packaging & Delivery

  • Flexible Formats: CpG ODNs provided lyophilized or in solution, depending on downstream application.
  • Customized Aliquoting: Convenient sizes and concentrations to simplify experimental workflow.
  • Comprehensive Documentation: Each delivery includes a full QC report with analytical validation data.
06

Post-Delivery Support

  • Technical Assistance: Our experts provide troubleshooting and optimization advice to ensure successful experimental application.
  • Long-Term Collaboration: For ongoing studies, we support batch-to-batch consistency and scale-up planning.
  • Knowledge Sharing: Access to recommendations on storage, stability, and application-specific handling.

This end-to-end workflow guarantees that every CpG ODN synthesized at BOC Sciences is scientifically robust, reproducible, and tailored to the researcher's exact specifications—ensuring that clients can progress with confidence from discovery to preclinical exploration.

Why Choose BOC Sciences for CpG ODN Synthesis?

Selecting the right partner for CpG oligonucleotide synthesis can dramatically influence research efficiency, data reliability, and project success. BOC Sciences distinguishes itself through a combination of scientific expertise, advanced technology, and client-focused flexibility.

End-to-End Expertise in Nucleic Acid Chemistry

Our team of seasoned scientists has decades of combined experience in DNA and RNA chemistry, enabling us to design, synthesize, and modify CpG ODNs with unmatched precision. From motif selection to structural optimization, we provide expert guidance that ensures your oligonucleotides achieve maximum biological effect.

Comprehensive Product Coverage

We provide all major classes of CpG ODNs (A, B, C, and P), along with fully customized variants. This broad coverage allows researchers to compare multiple structural designs and select the one most suitable for their project, whether focused on innate immune activation, antibody production, or combinational immunotherapy.

Flexible Customization Options

We understand that no two projects are alike. Whether you require phosphorothioate stabilization, fluorescent labeling, biotin conjugation, or conjugation-ready oligonucleotides, our platform delivers tailored solutions to fit your exact specifications.

Scalable Production Capacity

From milligram quantities for exploratory studies to gram-scale synthesis for extended preclinical projects, our scalable production ensures smooth progression through different stages of research without compromising quality.

By combining scientific excellence, stringent quality standards, and a client-first approach, BOC Sciences provides CpG ODN synthesis services that empower researchers to overcome technical barriers and accelerate breakthroughs in immunological and preclinical research.

Diverse Applications of CpG ODNs Synthesis Services

CpG oligonucleotides (CpG ODNs) are versatile immunostimulatory agents that act through TLR9-mediated pathways to modulate both innate and adaptive immunity. Their diverse structural classes and modifiable chemistries make them indispensable in multiple areas of preclinical research. BOC Sciences delivers CpG ODNs that are carefully designed, synthesized, and validated to support a wide spectrum of cutting-edge applications.

Vaccine Development and Adjuvants

CpG ODNs are among the most studied nucleic acid adjuvants due to their ability to promote strong Th1-polarized immune responses.

  • Enhanced Antigen Immunogenicity: They increase antigen presentation by dendritic cells and macrophages, amplifying both humoral and cellular responses.
  • Broad Disease Coverage: Applied in vaccine research against influenza, hepatitis B, malaria, and emerging viral pathogens.
  • Combination Strategies: Their synergy with protein- and peptide-based vaccines makes them particularly valuable in next-generation vaccine formulations.
  • Preclinical Validation: High-purity CpG ODNs with optimized stability ensure reliable data generation for regulatory submissions and translational studies.

Cancer Immunotherapy Research

Harnessing the immune system to fight cancer requires strong and sustained activation of innate and adaptive responses—an area where CpG ODNs excel.

  • Innate Immunity Boost: By stimulating plasmacytoid dendritic cells and natural killer (NK) cells, CpG ODNs promote antitumor cytokine secretion such as IFN-α.
  • Improved Antigen Presentation: They enhance dendritic cell maturation, resulting in more effective tumor antigen presentation to cytotoxic T cells.
  • Combination with Checkpoint Inhibitors: CpG ODNs complement anti-PD-1 or anti-CTLA-4 therapies, helping to overcome immune resistance in solid tumors.
  • Preclinical Oncology Models: Widely used in murine tumor models to test novel immunotherapy concepts before translation.

Autoimmune and Inflammatory Disease Models

CpG ODNs are powerful tools to dissect immune dysregulation mechanisms in autoimmunity.

  • Mechanistic Research: Controlled TLR9 activation provides models for diseases such as systemic lupus erythematosus (SLE), rheumatoid arthritis, and psoriasis.
  • Therapeutic Exploration: By testing CpG ODNs in disease models, researchers can evaluate pathways for immune modulation and potential interventions.
  • Cytokine Profiling: CpG ODNs enable the study of pathogenic cytokine cascades, helping to identify biomarkers and therapeutic targets.

Biomarker Discovery and Immunological Assays

CpG ODNs act as standardized immune triggers in both in vitro and in vivo systems, supporting discovery research and translational studies.

  • Cytokine Profiling: Serve as robust stimuli for measuring cytokine responses, enabling biomarker identification for disease monitoring or therapy response.
  • Assay Development: Frequently incorporated in ELISA, flow cytometry, and multiplex immunoassays to establish reproducible immune activation readouts.
  • Drug Screening Platforms: Used in high-throughput screening to assess the immunomodulatory properties of small molecules or biologics.
  • Comparative Studies: Enable benchmarking of immune activation across different CpG classes, providing valuable data for therapeutic development.

BOC Sciences empowers researchers to advance vaccine innovation, oncology breakthroughs, autoimmune disease modeling, allergy therapies, infectious disease research, and biomarker discovery. Each CpG ODN we synthesize is engineered for reproducibility, stability, and scientific impact.

Need a Consultation on CpG ODN Synthesis Services?

Contact BOC Sciences today to discuss your CpG ODN synthesis requirements and take the next step toward breakthrough scientific results.

Get A Quote

Related Products

Frequently Asked Questions (FAQ)

What is CpG ODN?

CpG oligonucleotides (CpG ODN) are short synthetic single-stranded DNA sequences that contain a relatively high proportion of cytidine-guanosine-dinucleotides (CpG). A typical CpG sequence motif consists of at least six nucleotides and a central CpG dinucleotide. Adjacent bases may be arbitrary and may include palindrome sequences. CpG motifs are common in bacterial and viral DNA, but very rare invertebrates and cytosine is also mainly in methylated form. This difference in the structure of bacterial/viral DNA and vertebrate DNA can be recognized by the immune system, which means that due to its different DNA structures, potential pathogens can be identified very quickly and effectively.

What is the Classification of CpG ODN?

Oligodeoxynucleotide (CpG ODN) containing unmethylated cytosine-guanine dinucleotide is a synthetic agonist of Toll-like receptor 9 (TLR9), which can activate humoral and cellular immunity and has been developed as a vaccine adjuvants to prevent or treat cancer, infectious diseases, and allergies. Different types of CpG ODNs have different structural characteristics and immune functions. They are generally divided into three types: Type A, Type B, and Type C. Type A With a palindromic sequence containing CpG dinucleotide as its core Poly G tails at both ends Partial phosphorothioated modifications on the phosphodiester bond skeleton Forming a high-level structure through the palindrome sequence and poly G tail to activate plasmacytoid dendritic cells and induce a large number of type I interferons Type B Linear CpG ODN modified with full phosphorothioates Have strong immunostimulatory activity on B cells, but cannot activate plasmacytoid dendritic cells Type C Modified with full phosphorothioates Form a dimer through the palindromic sequence, and have the activity of Class A and Class B CpG ODNs Activate both plasmacytoid dendritic cells and B cells Almost all CpG ODNs used in clinical trials are class B CpG (CpG-B) ODN (also known as K-type ODN). Class A CpG (CpG-A) ODN (also known as D-type ODN) has also been used, but in fewer clinical trials.

Class A CpG ODNs induce strong IFN-α secretion from plasmacytoid dendritic cells; Class B CpG ODNs primarily stimulate B-cell proliferation and antibody production; Class C combines both interferon induction and B-cell activation; Class P CpG ODNs are engineered for broader immune pathway activation. Choosing the right class depends on the specific immunological application.

Natural DNA backbones are rapidly degraded by nucleases in biological systems, limiting immunostimulatory activity. Phosphorothioate backbone modifications enhance stability, prolong half-life, and improve in vivo performance. BOC Sciences offers partial or full backbone modifications to balance efficacy, safety, and functional outcomes.

Yes. We provide biotin, fluorescent dyes (FAM, Cy3, Cy5), amino, and thiol modifications for applications such as tracking, affinity purification, imaging, and conjugation with delivery systems (e.g., liposomes, proteins, or nanoparticles). These modifications expand the utility of CpG ODNs in complex experimental settings.

CpG ODNs are typically stable for long-term storage when lyophilized and kept at -20 °C. In solution, stability depends on buffer composition and modification type. At BOC Sciences, we provide guidance on optimal storage conditions and can supply CpG ODNs in lyophilized form to ensure maximum shelf life.

Complementary Oligonucleotides Synthesis Services

CpG ODN Knowledge Center

Oligonucleotides Synthesis Knowledge Center

Online Inquiry
Verification code
Inquiry Basket
Loading Loading ......
Go to checkout