CpG oligonucleotides (CpG ODN)

CpG oligonucleotides (CpG ODN)

BOC RNA provides a variety of CpG oligonucleotides (CpG ODN) to help improve the immune stimulation response. All products are purified by HPLC and provided as lyophilized powder.

What is CpG ODN (CpG ODN)?

CpG oligonucleotides (CpG ODN) are short synthetic single-stranded DNA sequences that contain a relatively high proportion of cytidine-guanosine-dinucleotides (CpG). A typical CpG sequence motif consists of at least six nucleotides and a central CpG dinucleotide. Adjacent bases may be arbitrary and may include palindrome sequences.

CpG motifs are common in bacterial and viral DNA, but very rare invertebrates and cytosine is also mainly in methylated form. This difference in the structure of bacterial/viral DNA and vertebrate DNA can be recognized by the immune system, which means that due to its different DNA structures, potential pathogens can be identified very quickly and effectively.

Application and classification of CpG oligonucleotides (CpG ODN)

Oligodeoxynucleotide (CpG ODN) containing unmethylated cytosine-guanine dinucleotide is a synthetic agonist of Toll-like receptor 9 (TLR9), which can activate humoral and cellular immunity and has been developed as a vaccine adjuvants to prevent or treat cancer, infectious diseases, and allergies.

Different types of CpG ODNs have different structural characteristics and immune functions. They are generally divided into three types: Type A, Type B, and Type C.

Type A
  • With a palindromic sequence containing CpG dinucleotide as its core
  • Poly G tails at both ends
  • Partial phosphorothioated modifications on the phosphodiester bond skeleton
  • Forming a high-level structure through the palindrome sequence and poly G tail to activate plasmacytoid dendritic cells and induce a large number of type I interferons
Type B
  • Linear CpG ODN modified with full phosphorothioates
  • Have strong immunostimulatory activity on B cells, but cannot activate plasmacytoid dendritic cells
Type C
  • Modified with full phosphorothioates
  • Form a dimer through the palindromic sequence, and have the activity of Class A and Class B CpG ODNs
  • Activate both plasmacytoid dendritic cells and B cells

Almost all CpG ODNs used in clinical trials are class B CpG (CpG-B) ODN (also known as K-type ODN). Class A CpG (CpG-A) ODN (also known as D-type ODN) has also been used, but in fewer clinical trials.

BOC RNA provides these three types of CpG ODNs of various species.

Cat No.Product NameTypeSpeciesSequencePrice
BRO-00001CpG ODN 1585AMouse5’- ggGGTCAACGTTGAgggggg -3’Inquiry
BRO-00002Negative control for CpG ODN 15855'-ggGGTCAAGCTTGAgggggg-3'Inquiry
BRO-00003CpG ODN 2216AHuman5'-gggggaCGatCGtCGggggg-3'Inquiry
BRO-00004Negative control for CpG ODN 2216 (ODN 2243)5’- ggGGGAGCATGCTGgggggg -3’Inquiry
BRO-00005Biotinylated CpG ODN 2216AHuman5’-ggGGGACGATCGTCgggggg-3’Inquiry
BRO-00006FITC-labeled CpG ODN 2216AHuman5’-ggGGGACGATCGTCgggggg-3’Inquiry
BRO-00007CpG ODN 2336AHuman5’- gggGACGACGTCGTGgggggg -3’Inquiry
BRO-00008Negative control for ODN 23365’- gggGAGCAGCTGCTGgggggg -3’Inquiry
BRO-00009CpG ODN 1668BMouse5'-tccatgaCGttcctgatgct-3'Inquiry
BRO-00010Negative control for CpG ODN 16685'-tccatgagcttcctgatgct-3'Inquiry
BRO-00011FITC-labeled CpG ODN 1668BMouse5'-tccatgaCGttcctgatgct-3'Inquiry
BRO-00012CpG ODN 1826BMouse5'-tccatgaCGttcctgaCGtt-3'Inquiry
BRO-00013Negative control for CpG ODN 1826 (ODN 2138)5’- tccatgagcttcctgagctt -3’Inquiry
BRO-00014Biotin-labeled CpG ODN 1826BMouse5'-tccatgaCGttcctgaCGtt-3'Inquiry
BRO-00015FITC-labeled CpG ODN 1826BMouse5'-tccatgaCGttcctgaCGtt-3'Inquiry
BRO-00016CpG ODN 2006 (ODN 7909)BHuman5'-tCGtCGttttgtCGttttgtCGtt-3'Inquiry
BRO-00017Negative control for CpG ODN 2006 (ODN 2137)5’- tgctgcttttgtgcttttgtgctt -3’Inquiry
BRO-00018Biotin-labeled ODN 2006BHuman5'-tCGtCGttttgtCGttttgtCGtt-3'Inquiry
BRO-00019FITC-labeled ODN 2006BHuman5'-tCGtCGttttgtCGttttgtCGtt-3'Inquiry
BRO-00020CpG ODN 2006-G5BHuman5'-tCGtCGttttgtCGttttgtCGttggggg-3'Inquiry
BRO-00021Negative control for CpG ODN 2006-G55’- tgctgcttttgtgcttttgtgcttggggg -3’Inquiry
BRO-00022CpG ODN 2007BBovine/porcine5’- tCGtCGttgtCGttttgtCGt t -3’Inquiry
BRO-00023CpG ODN BW006 (ODN 684)BHuman/Mouse5’-tCGaCGttCGtCGttCGtCGttc-3’Inquiry
BRO-00024Negative control for CpG ODN BW006 (ODN BW007)5’-tgcagcttgctgcttgctgcttc-3’Inquiry
BRO-00025CpG ODN D-SL01BMultispecies5’-tCGCGaCGttCGccCGaCGttCGgta-3’Inquiry
BRO-00026CpG ODN 2395CHuman/ Mouse5'-tCGtCGttttCGgCGCGCGcCG-3'Inquiry
BRO-00027Negative control for CpG ODN 23955’-tgctgcttttggggggcccccc -3’Inquiry
BRO-00028FITC-labeled ODN 2395CHuman/ Mouse5'-tCGtCGttttCGgCGCGCGcCG-3'Inquiry
BRO-00029CpG ODN M362CHuman/ Mouse5’-tCGtCGtCGttCGaaCGaCGttgat-3’Inquiry
BRO-00030Negative control for CpG ODN M3625’- tgctgctgcttg:caagcagcttgat -3’Inquiry
BRO-00031CpG ODN D-SL03CMultispecies5’-tCGCGaaCGttCGcCGCGttCGaaCGCGg-3’Inquiry
BRO-00032CpG ODN C792CHuman/ Mouse5'-tCGaaCGaaCGaaCGttCGaaCGttCGaat-3'Inquiry
BRO-00033CpG ODN C274CHuman/ Mouse5'-tCGtCGaaCGttCGagatgat-3'Inquiry

Custom services

Custom manufacturing services are available to help develop or expand CpG oligonucleotides.

* Only for research. Not suitable for any diagnostic or therapeutic use.
Online Inquiry
Verification code