Name: Lumasiran sodium
Brand: BOC Sciences
Rating: 5 (1 reviews)

Lumasiran sodium

Lumasiran sodium is a siRNA product that reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).

* Please kindly note that our products are not to be used for therapeutic purposes and cannot be sold to patients.

Catalog

BRP-02073

Synonyms

ALN-G01 sodium; Oxlumo; RNA, (Gm-sp-Am-sp-Cm-Um-Um-Um-(2'-deoxy-2'-fluoro)C-Am-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)C-Um-Gm-Gm-Am-Am-Am-Um-Am-Um-Am), 3'-[[(2S,4R)-1-[29-[[2-(acetylamino)-2-deoxy-β-D-galactopyranosyl]oxy]-14,14-bis[[3-[[3-[[5-[[2-(acetylamino)-2-deoxy-β-D-galactopyranosyl]oxy]-1-oxopentyl]amino]propyl]amino]-3-oxopropoxy]methyl]-1,12,19,25-tetraoxo-16-oxa-13,20,24-triazanonacos-1-yl]-4-hydroxy-2-pyrrolidinyl]methyl hydrogen phosphate] sodium salt, complex with RNA (Um-sp-(2'-deoxy-2'-fluoro)A-sp-Um-Am-Um-(2'-deoxy-2'-fluoro)U-Um-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)C-Am-Gm-Gm-Am-(2'-deoxy-2'-fluoro)U-Gm-(2'-deoxy-2'-fluoro)A-Am-Am-Gm-Um-Cm-sp-Cm-sp-Am) sodium salt (1:21:1:22)

CAS

1834612-06-4

Molecular Weight

17,286 Da

Molecular Formula

C530H669F10N173O320P43S6Na43

Appearance

White to off-white solid

Storage

Store at -20 °C, stored under nitrogen, away from moisture

Sequence

RNA, (uauauuuccaggaugaaagucca) sodium salt, complex with RNA (gacuuucauccuggaaauaua), sodium salt (1:21:1:22)

Related CAS

1834610-13-7 (free acid)

Chemical Structure:

Our Products

BOC Sciences is a leading provider of DNA and RNA products and services that meet the needs of researchers and pharmaceutical companies worldwide. Its broad product portfolio includes various types of oligonucleotides, DNA/RNA synthesis feedstocks, RNA interference tools, and advanced drug delivery systems, among others. Designed to promote cutting-edge research and innovative therapeutic solutions, at BOC Sciences you are sure to find the right product for you.

Liposome Products