Name: Lepodisiran
Brand: BOC Sciences
Rating: 5 (1 reviews)

Lepodisiran

Lepodisiran is a long-duration small interfering RNA (siRNA) designed to lower the production of lipoprotein(a). It reduces the level of lipoprotein(a) by inhibiting the production of apolipoprotein(a), which is a component of lipoprotein(a).

* Please kindly note that our products are not to be used for therapeutic purposes and cannot be sold to patients.

Catalog

BRP-02906

Synonyms

LY-3819469; LY 3819469; LY3819469

Sequence

(3'-5')UUGCCAAGCUUGGUCAUCUAGCAGCCGAAAGGCUGC (5'-3')GGAACGGUUCGAACCAGUAGAU

Chemical Structure:

Our Products

MicroRNA Products

MicroRNA (miRNA) is a class of small, naturally occurring non-coding RNA molecules that have important roles in the regulation of life activities and disease genesis.

siRNA Products

Small interfering RNA (siRNA) is a stretch of RNA double-stranded between 20-25 nucleotides in length and is an important molecule in the RNAi process.

RNA Synthesis Reagents

BOC RNA offers high quality cap analogs, CPGs for oligo synthesis, nucleosides, nucleotides, and phosphoramidites for RNA synthesis.

Liposome Products

BOC RNA is dedicated to assisting you in exploring the complexity of liposomes, nucleic acid delivery mechanisms, and applications through our cutting-edge liposome delivery services.

mRNA Products

BOC RNA provides finished RNAs for you to choose from, supporting RNA-related research and drug development.