Name: ATU027
Brand: BOC Sciences
Rating: 5 (1 reviews)

ATU027

ATU027 is a siRNA, which silences expression of protein kinase N3 (PKN3) in the vascular endothelium. ATU027 has previously been shown to inhibit local tumor invasion as well as lymph node and pulmonary metastasis in mouse cancer models.

* Please kindly note that our products are not to be used for therapeutic purposes and cannot be sold to patients.

Catalog

BRP-02090

Synonyms

ATU 027; ATU-027; Atu027; RNA, (A-Gm-A-Cm-U-Um-G-Am-G-Gm-A-Cm-U-Um-C-Cm-U-Gm-G-Am-C-Am-A), complex with RNA (Um-U-Gm-U-Cm-C-Am-G-Gm-A-Am-G-Um-C-Cm-U-Cm-A-Am-G-Um-C-Um) (1:1)

CAS

1415935-22-6

Storage

Store at -20 °C

Sequence

RNA, (agacuugaggacuuccuggacaa), complex with RNA (uuguccaggaaguccucaagucu) (1:1)

Chemical Structure:

Our Products

BOC Sciences is a leading provider of DNA and RNA products and services that meet the needs of researchers and pharmaceutical companies worldwide. Its broad product portfolio includes various types of oligonucleotides, DNA/RNA synthesis feedstocks, RNA interference tools, and advanced drug delivery systems, among others. Designed to promote cutting-edge research and innovative therapeutic solutions, at BOC Sciences you are sure to find the right product for you.

Liposome Products