Tel:
Email:

Vutrisiran sodium

Catalog number: BRP-02068

Vutrisiran sodium

Vutrisiran sodium is a small interfering ribonucleic acid (siRNA) agent. It has been indicated for the treatment of the polyneuropathy of hereditary transthyretin-mediated amyloidosis in adults.

* Please kindly note that our products are not to be used for therapeutic purposes and cannot be sold to patients.
Catalog
BRP-02068
Synonyms
ALN-TTRsc02 sodium; Amvuttra sodium; Votrisiran sodium; (Um-sp-(2'-deoxy-2'-fluoro)C-sp-Um-Um-Gm-(2'-deoxy-2'-fluoro)G-Um-Um-(2'-deoxy-2'-fluoro)A-Cm-Am-Um-Gm-(2'-deoxy-2'-fluoro)A-Am-(2'-deoxy-2'-fluoro)A-Um-Cm-Cm-Cm-Am-sp-Um-sp-Cm), complex with RNA (Um-sp-Gm-sp-Gm-Gm-Am-Um-(2'-deoxy-2'-fluoro)U-Um-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)A-(2'-deoxy-2'-fluoro)U-Gm-Um-Am-Am-Cm-Cm-Am-Am-Gm-Am) 3'-[[(2S,4R)-1-[29-[[2-(acetylamino)-2-deoxy-β-D-galactopyranosyl]oxy]-14,14-bis[[3-[[3-[[5-[[2-(acetylamino)-2-deoxy-β-D-galactopyranosyl]oxy]-1-oxopentyl]amino]propyl]amino]-3-oxopropoxy]methyl]-1,12,19,25-tetraoxo-16-oxa-13,20,24-triazanonacos-1-yl]-4-hydroxy-2-pyrrolidinyl]methyl hydrogen phosphate] (1:1) sodium salt
Molecular Weight
17,290 Da
Molecular Formula
C530H672F9N171Na43O323P43S6
Appearance
White to off-white solid
Storage
Store at 2-8 °C, sealed storage, away from moisture
Sequence
RNA, (ucuugguuacaugaaaucccauc), complex with RNA (ugggauuucauguaaccaaga) (1:1), sodium salt
Related CAS
1867157-35-4 (free acid)

Chemical Structure:


Our Products

BOC Sciences is a leading provider of DNA and RNA products and services that meet the needs of researchers and pharmaceutical companies worldwide. Its broad product portfolio includes various types of oligonucleotides, DNA/RNA synthesis feedstocks, RNA interference tools, and advanced drug delivery systems, among others. Designed to promote cutting-edge research and innovative therapeutic solutions, at BOC Sciences you are sure to find the right product for you.

Online Inquiry
Verification code
Inquiry Basket